View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8576_high_7 (Length: 290)
Name: NF8576_high_7
Description: NF8576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8576_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 33006976 - 33007225
Alignment:
| Q |
18 |
cacagaaccaaatccttgcactgtggaatcaccggctacgcttttaatcaaacaccttccagacgctattcctcatgataccctttctcgcctcttgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33006976 |
cacagaaccaaatccttgcactgtggaatccccggctacgcttttaatcaaacaccttccagacgctattcctcatgataccctttctcgcctcttgtct |
33007075 |
T |
|
| Q |
118 |
cattacggtgcttcctctgttcgccctcgctctgctggaaggtatcattcacatatttacattccttgttccaattcatttgtgttcatcatgtatgtac |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33007076 |
cattacggtgcttcctctgttcgcccttgctctgctggaaggtatcattcacatatttacattccttgttccaattcatttgtgttcatcatgtatgaac |
33007175 |
T |
|
| Q |
218 |
acacacgatagtgagaagtagacattttgataataatttatgatattgga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33007176 |
acacacgatagtgagaagtagacattttgataataatttatgatattgga |
33007225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University