View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8576_low_14 (Length: 273)
Name: NF8576_low_14
Description: NF8576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8576_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 1158718 - 1158937
Alignment:
| Q |
1 |
ctgattttctttgaataacaaatccttgttttgtaccacatatgaggtaccttgtagagtacatcggaccgctgattaaaaacacgaatgttaattgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||||||||| |
|
|
| T |
1158718 |
ctgattttctttgaataacaaatccttgttttgtaccacatatgaggtacctt-------agcttg------tgattaaaaacacgaatgttaattgtat |
1158804 |
T |
|
| Q |
101 |
atgttcttcaatcaagagtgaaacctatttgatt-ctgctaatgcctaaaatcttttaacatatcacaattagcttgatcgacaatacgatgacactaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1158805 |
atgttcttcaatcaagagtgaaacctatttgatttctgctaatgcctaaaatcttttaacatgtcacaattagcttgatcgacaacacgatgacactaaa |
1158904 |
T |
|
| Q |
200 |
aggaatgcatgtcgattttcattaatctcatga |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1158905 |
aggaatgcatgtcgattttcattaatctcatga |
1158937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University