View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8576_low_19 (Length: 220)

Name: NF8576_low_19
Description: NF8576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8576_low_19
NF8576_low_19
[»] chr4 (2 HSPs)
chr4 (65-180)||(7321924-7322039)
chr4 (21-65)||(7322059-7322103)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 65 - 180
Target Start/End: Complemental strand, 7322039 - 7321924
Alignment:
65 atttgtgaggataatcgaggttctggtttgccatttagggatgacttcctgaatttgttctggtttgcaatttagtaagtgtattatagattatgttttt 164  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
7322039 atttgtgaggataatcgaggttctggtttgccatttagggaggacttcctgaatttgttctggtttgcaatttagtatgtgtattatagattatgtgttt 7321940  T
165 cacatataatttagtt 180  Q
    | ||||||||||||||    
7321939 cgcatataatttagtt 7321924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 7322103 - 7322059
Alignment:
21 ctatgtctctagagatgcaaataaagttgcagacaatttagccaa 65  Q
    |||||||||||||||||||| ||||||||||||||||||||||||    
7322103 ctatgtctctagagatgcaactaaagttgcagacaatttagccaa 7322059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University