View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_high_12 (Length: 341)
Name: NF8577_high_12
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 151 - 282
Target Start/End: Complemental strand, 38838104 - 38837975
Alignment:
| Q |
151 |
caggattaagtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaatatggtcatccaccac |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838104 |
caggattaggtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaatatggtcatccaccac |
38838005 |
T |
 |
| Q |
251 |
attctgcttgtctgtatagtaatggttttgat |
282 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |
|
|
| T |
38838004 |
attctgcttatctg--tagtaatggttttgat |
38837975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University