View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_high_13 (Length: 324)
Name: NF8577_high_13
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 299
Target Start/End: Complemental strand, 35689723 - 35689441
Alignment:
| Q |
17 |
cattatcttccttgagagaatgatccaaatttagggaccaatttctttgcatcagggagcgtatgtcagccactaagctaccataggcatcatgctcaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35689723 |
cattatcttccttgagagaatgatccaaattaagggaccaatttctttgcatcagggagcgtatgtcagccactaagctaccataggcatcatgctcaat |
35689624 |
T |
|
| Q |
117 |
attggcctcctcaatgtgcttgatagcttccaagtaatcagtttcaactaatatatttctgtaaccgaaatcccaagctgtgatcaaaccttgacatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35689623 |
attggcctcctcaatgtgcttgatagcttccaagtaatcagtttcaactaatatatttctgtaaccgaaatcccaagctgtgatcaaaccttgacatatg |
35689524 |
T |
|
| Q |
217 |
gcataaagttcagctttcattttagttgtaaagcccagagagccatagaacccaccaagccaattcccatccacaacacgaaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35689523 |
gcataaagttcagctttcattttagttgtaaagcccagagagccatagaacccaccaagccaattcccatccacatcacgaaa |
35689441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University