View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_high_22 (Length: 276)
Name: NF8577_high_22
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 45 - 144
Target Start/End: Original strand, 7229309 - 7229408
Alignment:
| Q |
45 |
tctattgttgaatgttgttttttatttctttctaattttgaatgcatttcaggtgattggtgataaggagaatttaagaatgatctttttctatttgctt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7229309 |
tctattgttgaatgttgttttttatttctttctaattttgaatgcatttcaggtgattggtgataaggagaatctaagaatgatctttttctatgtgctt |
7229408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 174 - 264
Target Start/End: Original strand, 7229400 - 7229490
Alignment:
| Q |
174 |
tatgtgcttcaaccccttctcaaaaattcccattcataacacattattttctcttcatgaatgtgtttataaatcaaagccactctgtctc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7229400 |
tatgtgcttcaaccccttctcaaaaattcccattcataacacattattttctcttcatgaatgtgtttataaatcaaagccactctgtctc |
7229490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University