View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_high_28 (Length: 242)
Name: NF8577_high_28
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 50 - 224
Target Start/End: Original strand, 36946753 - 36946927
Alignment:
| Q |
50 |
tgtaaagttattaatcttttcgtttataactatattcaagtccgttttttctgtaggctaagcaagtactggctaaaaggagataaagctggagctttag |
149 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||||||||||||||| ||||||||||||| || ||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
36946753 |
tgtaaagttattaaacttttcatttattactatattcaagtcccttttttctgtaggttatgcaagtattggctaaaaggagataaagctggaactttag |
36946852 |
T |
|
| Q |
150 |
aaatcttagcaatcctacctggttttgctgacaatgtgagagtcaacgaaaatggtgacttttgggtggctatcc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946853 |
aaatcttagcaatcctacctggttttgccgacaatgtgagagtcaacgaaaatggtgacttttgggtggctatcc |
36946927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 6 - 44
Target Start/End: Original strand, 36946631 - 36946669
Alignment:
| Q |
6 |
atattttgccattctgacacaatatgtttagaaagtaat |
44 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36946631 |
atattttcccattctgacacaatatgtttagaaagtaat |
36946669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University