View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_low_22 (Length: 387)
Name: NF8577_low_22
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 7 - 374
Target Start/End: Original strand, 42666757 - 42667124
Alignment:
| Q |
7 |
gtatcatagagattagacctccccatcccctgcttcttcatagaattcattttctccatccttaaaccagctctgaaactttcaatgaaactaccagctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666757 |
gtatcatagagattagacctccccatcccctgcttcttcatagaattcattttctccatccttaaaccagctctgaaactttcaatgaaactaccagctt |
42666856 |
T |
|
| Q |
107 |
tgttatcaacaccggggttgggatttggatacaccaatagatcaattccagtttcttcaccactaatggttggtaactccactacttcctcatctatatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666857 |
tgttatcaacaccggggttgggatttggatacaccaatagatcaattccaggttcttcgccactaatggttggtaactccactacttcctcatctatatc |
42666956 |
T |
|
| Q |
207 |
taccgaacttgaactactaatgctatctattctaacaaagtcaccctgcaccttgaacttccatgctggcatcttgaacggaggtggaggaggaggcggt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42666957 |
taccgaacttgaactactaatgctatctattctaacaaagtcaccctgcaccttgaacttccatgctggcatcttgaacggaggtggaggaggaggcggt |
42667056 |
T |
|
| Q |
307 |
ggaggtattgagttcaatggcgactcattaccagtaatcacagaaaaatcctcatcctttgtttttga |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667057 |
ggaggtattgagttcaatggcgactcattaccagtaatcacagaaaaatcctcatcctttgtttttga |
42667124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University