View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_low_30 (Length: 324)
Name: NF8577_low_30
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 17 - 314
Target Start/End: Complemental strand, 10369057 - 10368760
Alignment:
| Q |
17 |
attgccatagcgatgcttgaatcgcgtattaacgctcccattatattgcttgcaaacggcattgctactcccatagagttgaggtaacctgcttcgcaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369057 |
attgccatagcgatgcttgaatcgcgtattaacgctcccattatattgcttgcaaacggcattgctactcccatagagttgaggtaacctgcttcgcaca |
10368958 |
T |
|
| Q |
117 |
ctctgcatctttatgtctgtgttgtcaaatagcggataatggaattttaacaaaatgatatcgttctgcgatacacaattttaatagaaagtgttgtcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368957 |
ctctgcatctttatgtctgtgttgtcaaatagcggataatggaattttaacaaaatgatatcgttctgcgatacacaattttaatagaaagtgttgtcaa |
10368858 |
T |
|
| Q |
217 |
ataacactttaacacaagtttaagtcctaattgaaagatttatttggcatatttcagtttgattgtaccatttctgcgcttcggtgaatttatctctg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368857 |
ataacactttaacacaagtttaagtcctaattgaaagatttatttggcgtatttcagtttgattgtaccatttctgcgcttcggtgaatttatctctg |
10368760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 582870 - 582823
Alignment:
| Q |
267 |
atttcagtttgattgtaccatttctgcgcttcggtgaatttatctctg |
314 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
582870 |
atttcagtctgattgtaccgtttctacgcttcggtgaatttatgtctg |
582823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 219
Target Start/End: Complemental strand, 26305753 - 26305693
Alignment:
| Q |
158 |
gaattttaacaaaatgatatcgttctgcgatacacaattttaatagaaagtgttgtcaaata |
219 |
Q |
| |
|
||||||||||||| || |||||||| ||||||||||| |||| || | |||||||||||||| |
|
|
| T |
26305753 |
gaattttaacaaattgttatcgttcggcgatacacaa-tttagtacacagtgttgtcaaata |
26305693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University