View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_low_36 (Length: 308)
Name: NF8577_low_36
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 36124201 - 36123997
Alignment:
| Q |
1 |
gcttgtgaaactatagtcttaatattgcatggtttcctagtatcttgattgtaacaaggttacttctcatgctttcacatgcaccttgttgtcattcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36124201 |
gcttgtgaaactatagtcttaatattgcatggtttcctagtatcttgagtgtaacaaggttacttctcatgctttcacatgcaccttgttgtcattcttc |
36124102 |
T |
 |
| Q |
101 |
atatattaaggtccgtca-tccccttgatttcttccatactggttcctagttaactacttaaggttgactgattacacttaaatcagtgttgggaacttc |
199 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
36124101 |
atatattaaggtccgtcatttcctttgatttcttccatactggttcctagttaactacttaaggttgactgattacacggaaataagtgttgggaacttg |
36124002 |
T |
 |
| Q |
200 |
tcatg |
204 |
Q |
| |
|
||||| |
|
|
| T |
36124001 |
tcatg |
36123997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 291
Target Start/End: Complemental strand, 36124000 - 36123947
Alignment:
| Q |
237 |
catgtcatgaacaaagtactttaaaattttctctttacgtgcttgccttacatgt |
291 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
36124000 |
catgtcatgaacaaagtactttcaa-ttttctctttacgtgcttgccttacatgt |
36123947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University