View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_low_49 (Length: 256)
Name: NF8577_low_49
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 248
Target Start/End: Complemental strand, 30610785 - 30610532
Alignment:
| Q |
4 |
aatacttgatcttaattcgatgaaatggagtgtgaagagtagttggcaagtgtccgactctcaagcaaaactgagtgaagcttgaaatcttcatattact |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30610785 |
aatacttgatcttaattcgataaaatggagtgtgaagagt---tggcaagtgtccgactctcaagcaaaactgaatgaagcttgaaatcttcatattact |
30610689 |
T |
 |
| Q |
104 |
aagcaagtttagttgttcatgatatgata------------cttttgaatcggcatgcatttacttttccatcttcagagagggaattctctcaattgga |
191 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30610688 |
aagcaagtttagttgttcatgatgtgataatcattgtgtaacttttgaatcggcatgcatttacttttccatcttcagaaagggaattctctcaattgga |
30610589 |
T |
 |
| Q |
192 |
ttcctctcaattttctttttcaattgtatcatcttaagtcttaaccatcaaacacga |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30610588 |
ttcctctcaattttttttttcaattgtatcatcttaagtcttaaccatcaaacacga |
30610532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University