View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8577_low_53 (Length: 250)
Name: NF8577_low_53
Description: NF8577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8577_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 31454927 - 31454687
Alignment:
| Q |
1 |
tgcttcaactctttgtgaagatgggtgtattcttgttggcaaactaattgatcttaatggttgatgagtagatggtaacattgaaattgtttccattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454927 |
tgcttcaactctttgtgaagatgggtgtattcttgttggcaaactaattgatcttaatggttgatgagtagatggtaacattgaaattgtttccattttt |
31454828 |
T |
|
| Q |
101 |
cttcttcttcttttgttgtttacttagaagtgcaataaaacaagggttaaatgttgcttgttttgcaattagtgtttcttcaatctatttataggaatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454827 |
tttcttcttcttttgttgtttacttagaagtgcaataaaacaagggttaaatgttgcttgttttgcaattagtgtttcttcaatctatttataggaatgt |
31454728 |
T |
|
| Q |
201 |
ggtaaaagagaattatagaaatttaattatttgagtattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454727 |
ggtaaaagagaattatagaaatttaattatttgagtattat |
31454687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University