View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8578_high_19 (Length: 238)
Name: NF8578_high_19
Description: NF8578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8578_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 52465315 - 52465097
Alignment:
| Q |
1 |
aatttagggaca--gagaaaattattcaaaaattattttaaatttgttgtccaaatatgatagatgaagaaacatgttatttgtacaaagtagtg--ata |
96 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||| |
|
|
| T |
52465315 |
aatttagggacaaagagaaatttattcaaaaattattttaaatttgttgtccaaatatgatagatgaagaaatatgt-----gtacaaagtagtgtgata |
52465221 |
T |
 |
| Q |
97 |
catagtagggattggggagtaatattctctttacttgtattgttgtatgtcgacagaactatacagtacaccaacaagtgggtcaagatattttgttctg |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52465220 |
cataatagggattggggagtaatattctctttacctgtattgttgtatgtcgacagaactatacagtacaccaacaagtgggtcaagatattttgttctg |
52465121 |
T |
 |
| Q |
197 |
atgaagagacgtgataacgtgata |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52465120 |
atgaagagacgtgataacgtgata |
52465097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University