View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8578_high_6 (Length: 431)
Name: NF8578_high_6
Description: NF8578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8578_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 18 - 413
Target Start/End: Original strand, 43606966 - 43607361
Alignment:
| Q |
18 |
agcagagccaacccataacattcacccaaacaagaacaaggaagggatttcatccttctacttcacaactcatagtacttgctactcttgtaccttttgg |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43606966 |
agcagaaccaacccataacattcacccaaacaagaacaaggaagggatttcatccttctacttcacaactcatagtacttgctactcttgtaccttttgg |
43607065 |
T |
 |
| Q |
118 |
agcaactcttctcattcttgctggtctcacactcactgccaccgttgtcggcctcgctgtcaccacccctctgttcattttcttcagccccattttgtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607066 |
agcaactcttctcattcttgctggtctcacactcactgccaccgttgtcggcctcgctgtcaccacccctctgttcattttcttcagccccattttgtta |
43607165 |
T |
 |
| Q |
218 |
gctgcggctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtattacctcgctttcttcctttgcttgggtagcatcatatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607166 |
gctgcggctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtattacctcgctttcttcctttgcttgggtagcatcatatc |
43607265 |
T |
 |
| Q |
318 |
tccgtcgttcacggtttctggagaaggttaacgttaaacatcatcatcatgcaattgcaaagccgccacgtttggatgcggatgagactttggggc |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43607266 |
tccgtcgttcacggtttctggagaaggttaacgttaaacatcatcatcatgcaattgcaaagccgccacgttttgatgcggatgagactttggggc |
43607361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University