View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8578_low_23 (Length: 243)
Name: NF8578_low_23
Description: NF8578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8578_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 45 - 224
Target Start/End: Original strand, 32025128 - 32025307
Alignment:
| Q |
45 |
tggtaaccattgagctcgattacgataggttaatacttttgtattacttctacaaatgtattattatcttttaataatatgttttaaatgttaatataaa |
144 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32025128 |
tggtaaccgttgagctcgattacgataggttaatacttttgtattacttctacaaatgtattattattttttaataatatgttttaaatgttaatataaa |
32025227 |
T |
 |
| Q |
145 |
tttatttttgtagattcaaatataaggtcactacgtttggacaatatgtggaaaaacttcatacttttgttggtgtcgga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32025228 |
tttatttttgtagattcaaatataaggtcactacatttggacaatatgtggaaaaacttcatacttttgttggtgtcgga |
32025307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University