View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8578_low_23 (Length: 243)

Name: NF8578_low_23
Description: NF8578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8578_low_23
NF8578_low_23
[»] chr2 (1 HSPs)
chr2 (45-224)||(32025128-32025307)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 45 - 224
Target Start/End: Original strand, 32025128 - 32025307
Alignment:
45 tggtaaccattgagctcgattacgataggttaatacttttgtattacttctacaaatgtattattatcttttaataatatgttttaaatgttaatataaa 144  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
32025128 tggtaaccgttgagctcgattacgataggttaatacttttgtattacttctacaaatgtattattattttttaataatatgttttaaatgttaatataaa 32025227  T
145 tttatttttgtagattcaaatataaggtcactacgtttggacaatatgtggaaaaacttcatacttttgttggtgtcgga 224  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
32025228 tttatttttgtagattcaaatataaggtcactacatttggacaatatgtggaaaaacttcatacttttgttggtgtcgga 32025307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University