View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8579_high_4 (Length: 248)
Name: NF8579_high_4
Description: NF8579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8579_high_4 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 107 - 248
Target Start/End: Original strand, 14257669 - 14257810
Alignment:
| Q |
107 |
ttgaatttatactcaatagtactatctatatttttcgatagagtaattagtcttctcactttggtggggaacatattggttagtttctagaagacattat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14257669 |
ttgaatttatactcaatagtactatctatatttttcgatagagtaattagtcttctcactttggtggggaacatattagttagtttctagaagacattat |
14257768 |
T |
 |
| Q |
207 |
aacaaattggctagactttactcgagtttgaattttcacttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14257769 |
aacaaattggctagactttactcgagtttgaattttcacttc |
14257810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 20 - 115
Target Start/End: Original strand, 14257050 - 14257145
Alignment:
| Q |
20 |
cagtggttaaaagaatagatgagaagaattacttgtccatggccataacaaccacatgtaaacagcactttcaaaagtagcatgttattgaattta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14257050 |
cagtggttaaaagaatagatgagaagaattacttgtccatggccataacaaccacatgtaaacagcactttcaaaagtagcatgttattgaattta |
14257145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University