View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8579_high_5 (Length: 216)

Name: NF8579_high_5
Description: NF8579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8579_high_5
NF8579_high_5
[»] chr2 (1 HSPs)
chr2 (2-200)||(3468206-3468404)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 200
Target Start/End: Complemental strand, 3468404 - 3468206
Alignment:
2 ggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggctgtggagttacttggggagggatcagagc 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3468404 ggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggctgtggagttacttggggagggatcagagc 3468305  T
102 tttcatcttggtcttcgttttcttcgacttcatcggaggaagatatttgctcattagggaagaattggaaacttggaggatactcttcaaggattatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
3468304 tttcatcttggtcttcgttttcttcgacttcatcggaggaagatatttgctcattagggaagaattggaaacttggaggattctcttcaaggattatga 3468206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University