View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8579_high_5 (Length: 216)
Name: NF8579_high_5
Description: NF8579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8579_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 200
Target Start/End: Complemental strand, 3468404 - 3468206
Alignment:
| Q |
2 |
ggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggctgtggagttacttggggagggatcagagc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3468404 |
ggtggtccaccggaggatttagttcagctggtaaaggagaggctgcatgagcagaatctcgacaacgcggctgtggagttacttggggagggatcagagc |
3468305 |
T |
 |
| Q |
102 |
tttcatcttggtcttcgttttcttcgacttcatcggaggaagatatttgctcattagggaagaattggaaacttggaggatactcttcaaggattatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3468304 |
tttcatcttggtcttcgttttcttcgacttcatcggaggaagatatttgctcattagggaagaattggaaacttggaggattctcttcaaggattatga |
3468206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University