View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8579_low_6 (Length: 248)

Name: NF8579_low_6
Description: NF8579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8579_low_6
NF8579_low_6
[»] chr6 (2 HSPs)
chr6 (107-248)||(14257669-14257810)
chr6 (20-115)||(14257050-14257145)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 107 - 248
Target Start/End: Original strand, 14257669 - 14257810
Alignment:
107 ttgaatttatactcaatagtactatctatatttttcgatagagtaattagtcttctcactttggtggggaacatattggttagtttctagaagacattat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
14257669 ttgaatttatactcaatagtactatctatatttttcgatagagtaattagtcttctcactttggtggggaacatattagttagtttctagaagacattat 14257768  T
207 aacaaattggctagactttactcgagtttgaattttcacttc 248  Q
    ||||||||||||||||||||||||||||||||||||||||||    
14257769 aacaaattggctagactttactcgagtttgaattttcacttc 14257810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 20 - 115
Target Start/End: Original strand, 14257050 - 14257145
Alignment:
20 cagtggttaaaagaatagatgagaagaattacttgtccatggccataacaaccacatgtaaacagcactttcaaaagtagcatgttattgaattta 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14257050 cagtggttaaaagaatagatgagaagaattacttgtccatggccataacaaccacatgtaaacagcactttcaaaagtagcatgttattgaattta 14257145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University