View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_17 (Length: 319)
Name: NF8580_high_17
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_17 |
 | |
|
| [»] scaffold0421 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0421 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 21 - 319
Target Start/End: Original strand, 13469 - 13767
Alignment:
| Q |
21 |
tcccaaacttcgatctttgaccgccatctcctcctagtctccgatctccgaccgccatctcttcccagtctccgacggccgcattctctcaaacggtctc |
120 |
Q |
| |
|
|||||| || || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
13469 |
tcccaatctccggtctttgaccgccatctcctcatagtctccgatctccgaccgccatctcttcccagtctccgacggctgcattctctctaacggtctc |
13568 |
T |
|
| Q |
121 |
ttctccttctgcaattcaacattgactattgtctccgtcgccgaatcaaaccgttgaaggtgatgtatatcttaaatcttgtattgttttcgattgacca |
220 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
13569 |
ttctccttctgcgattcaacatcgactgctgtctccgtcgccgaatcaaaccgttgaaggtgatgtatattttaaatcttgtattgttttcaattgacca |
13668 |
T |
|
| Q |
221 |
gcttgtatagtataaattatggtgtcactttagactttatgtagctaattgtttgattgaattactacatcaaatttctcttgcgcacacagatttcaa |
319 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
13669 |
gcttgtatagtataaattatggtgccactttagactttatgtagctaactgttaaattgaattactacatcaaatctctcttgcgcacacaaatttcaa |
13767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 39034016 - 39033975
Alignment:
| Q |
42 |
cgccatctcctcctagtctccgatctccgaccgccatctctt |
83 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39034016 |
cgccatctcctcccagtctccgatctccgaccgccatctctt |
39033975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 73 - 126
Target Start/End: Complemental strand, 47345372 - 47345319
Alignment:
| Q |
73 |
cgccatctcttcccagtctccgacggccgcattctctcaaacggtctcttctcc |
126 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
47345372 |
cgccatctcctcccaatctccgaccgccgcattctctctaacgatctcttctcc |
47345319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 124
Target Start/End: Original strand, 3798187 - 3798236
Alignment:
| Q |
75 |
ccatctcttcccagtctccgacggccgcattctctcaaacggtctcttct |
124 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
3798187 |
ccatctcctctcagtctccgaccgccgcattctctctaacgatctcttct |
3798236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 34165028 - 34164988
Alignment:
| Q |
42 |
cgccatctcctcctagtctccgatctccgaccgccatctctt |
83 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
34165028 |
cgccatctcctcc-agtctccgatctccgaccgtcatctctt |
34164988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University