View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_18 (Length: 317)
Name: NF8580_high_18
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 31038682 - 31038462
Alignment:
| Q |
17 |
caaatgatgatttggttattacatcatttgtattttattcaattacatatattttctagcgtatttattttaatgtagtgagaatgatttgtctatgttt |
116 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31038682 |
caaattatgatttggttattacattatttgtattttattcaattacagatattttctagcgtatttattttaatgtagtgagaatgatttgtctatgttt |
31038583 |
T |
 |
| Q |
117 |
tttgtttgcttgatgagaaatttacaaatttacatgcatcaatgataaaacatcatgtttaattcattcatgcttcttaaaagagattgagttcatgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31038582 |
tttgtttgcttgatgagaaatttacaaatttacatgcatcaatgataaaacatcatgtttaattcattcatgcttcttaaaagagattgagttcatgttt |
31038483 |
T |
 |
| Q |
217 |
ggttatatgtaaagtgattta |
237 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
31038482 |
ggttacatgtaaagtgattta |
31038462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University