View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_22 (Length: 306)
Name: NF8580_high_22
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 25525380 - 25525489
Alignment:
| Q |
185 |
cctcttgaagaaaatctgcaacacccttgcgtggtggaagtttgaaacttaatgattcaaaaaattctaccacatgttctatggggccttgatatactag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25525380 |
cctcttgaagaaaatctgcaacacccttgcgtggtggaagtttgaaacttaatgattcaaaaaattctaccacatgttctatggggccttgatatactat |
25525479 |
T |
|
| Q |
285 |
atgtccatct |
294 |
Q |
| |
|
|||||||||| |
|
|
| T |
25525480 |
atgtccatct |
25525489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 25525196 - 25525293
Alignment:
| Q |
1 |
tttgaaggcttctgcaatctctggtactggaataaatttatacggctttgaagaatcagcccagtattgtgcttgatcttttttagatgttacctggt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25525196 |
tttgaaggcttctgcaatctctggtactggaataaatttatacggctttgaagaatcagcccagtattgtgcttgatcttttttagatgttacctggt |
25525293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 96
Target Start/End: Complemental strand, 29774637 - 29774546
Alignment:
| Q |
5 |
aaggcttctgcaatctctggtactggaataaatttatacggctttgaagaatcagcccagtattgtgcttgatcttttttagatgttacctg |
96 |
Q |
| |
|
||||||||||||||||| | |||| ||||||| ||| || || |||| |||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
29774637 |
aaggcttctgcaatctcacgaactgagataaattcatatggtttagaaggatcagcccagtattgtgcttgatcctttttagaggtgacctg |
29774546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 185 - 280
Target Start/End: Complemental strand, 29774467 - 29774372
Alignment:
| Q |
185 |
cctcttgaagaaaatctgcaacacccttgcgtggtggaagtttgaaacttaatgattcaaaaaattctaccacatgttctatggggccttgatata |
280 |
Q |
| |
|
|||||||||| || ||||||| ||||| ||||||||||||| |||| || ||| ||||||||||| | ||||| |||| | ||||||| ||||| |
|
|
| T |
29774467 |
cctcttgaaggaagtctgcaatccccttacgtggtggaagttgaaaacctattgactcaaaaaattcaagcacatcttctctagggccttcatata |
29774372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University