View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_29 (Length: 264)
Name: NF8580_high_29
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 78 - 240
Target Start/End: Original strand, 31423810 - 31423972
Alignment:
| Q |
78 |
tcacgttggttttgtgtggttgtttggtgtggtactgttagcggtggagcgagatggttgcgtaggtttgtgtagttgtgtgtgatggtttgtagcgttc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31423810 |
tcacgttggttttgtgtggttgtttggtgtggtactgttagcagtggagcgagatggttgtgtaggtttgtgtagtggtgtgtgatggtttgtagcgttc |
31423909 |
T |
|
| Q |
178 |
ggatggggtggtcgtggataattttgactccgatttggcattgatacgattgatagacaagag |
240 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31423910 |
ggatggggtgattgtggataatttggactccgatttggcattgatacgattgatagacaagag |
31423972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University