View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_40 (Length: 240)
Name: NF8580_high_40
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 36464461 - 36464683
Alignment:
| Q |
17 |
agatgacatgttcaattctcattttttgttggctaaatttatatgttaaaatttgtcgaaatattgtaccccgctttaatgattgtttgtggtgcataga |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36464461 |
agatgacatgtttaattctcattttttgttggttaaatttatatgttaaaatttgtcgaaatattgtaccccgctttaatgattgtttgtggtacataga |
36464560 |
T |
|
| Q |
117 |
gtttgacatggtcatgctgcaaagcaagattccatttcttttgtagatgatcgttgaagaatgttaaatgtgtttgtactgttggagtgctttagcagca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464561 |
gtttgacatggtcatgctgcaaagcaagattccatttcttttgtagatgatcgttgaagaatgttaaatgtgtttgtactgttggagtgctttagcagca |
36464660 |
T |
|
| Q |
217 |
atttttctcattttttgtaagtt |
239 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
36464661 |
atttttctcattttttgaaagtt |
36464683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University