View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_43 (Length: 226)
Name: NF8580_high_43
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 37112523 - 37112688
Alignment:
| Q |
1 |
gaagaatttgaaggagaaagtgaagggtaggagttggtaaccccattgctttgagaaattcaa-tcttttgctttgtttttcaatgcaatagaagcaaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37112523 |
gaagaatttgaaggagaaagtgaagggtaggaattggtaaccccattgctttgagaaattcaactcttttgctttgtttttcaatgcaatagaagcaaaa |
37112622 |
T |
 |
| Q |
100 |
ccttgggttttataacggaacagtatgaatattaccctgcttctgaaaaaaacgatttttgtataa |
165 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37112623 |
ccttgggttttataaaggaacgatatgaatattaccctgcttctgaaaaaaacgatttttgtataa |
37112688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University