View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_45 (Length: 221)
Name: NF8580_high_45
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45246412 - 45246188
Alignment:
| Q |
1 |
aaatagtatttcttcatacttggtgatacaaattgtctatcattttgacaaagtatttagtatttctgctatctgtcttagcagagtctgaaatcatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45246412 |
aaatagtatttcttcatacttggtgatacaaattgtctatcattttgacaaagtatttagtatttctgctatctgtcttagcagagtctgaaatcatgta |
45246313 |
T |
|
| Q |
101 |
ccga----atagcacaagtatgagaacttgagtaaaatatctattcatttaattatatgtaatgatgaagaatcaaagcacaaatatatttgagttcaaa |
196 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45246312 |
ccgatcgaatagcacaaatatgagaacttgagtaaaatatctattcatttaattatatgtaatgatgaagaatcaaagcacaaatatatttgagttcaaa |
45246213 |
T |
|
| Q |
197 |
tgacaaaatacacaatgataaagaa |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45246212 |
tgacaaaatacacaatgataaagaa |
45246188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University