View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_high_47 (Length: 208)
Name: NF8580_high_47
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 41142823 - 41143002
Alignment:
| Q |
18 |
tttccaataaatttatttaaagtaacaccaaaccaattcgataatgatcaaaatattacttaatagagtatagccccatnnnnnnnngtta---tagtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||| ||| || |
|
|
| T |
41142823 |
tttccaataaatttatttaaagtaacaccaaaccaattagataatgatcaaaatattacttaatagagtatagccccgtaaaaaaaagttaatatagaac |
41142922 |
T |
 |
| Q |
115 |
gaagtatgtttagcttctctttaattctatgaaataacaaaatgctacactcacccacaattggatagaaggagtattat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41142923 |
taagtatgtttagcttctctttaattctatgaaataacaaaatgctacactcacccacaattggatagaaggagtattat |
41143002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University