View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_24 (Length: 338)
Name: NF8580_low_24
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 293
Target Start/End: Original strand, 10091991 - 10092270
Alignment:
| Q |
15 |
gttttgtggtgaatatatactctaaatgctttt-aaatgagaaaaggttgatgtggaataagtttatacatgttaaaaggttcattggtgggcatgcttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
10091991 |
gttttgtggtgaatatatactctaaattctttttaaatgagaaaaggttgatgtggaataagtttatgcatgttaaagggttcattggtgtgcatgcttg |
10092090 |
T |
|
| Q |
114 |
gtgcgttgtcaatgattttaactcggttcccacgacatcagaaacgagaggggtggcaatggtgagtccgggggcgttgatggtgtttcccaggagttcg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
10092091 |
atgcgttgtcaatgattttaactcggttcccacgacatcagaaacgagaggggtggcaatggtgagttcaggggcgttgatggtgtttcccaggagttcg |
10092190 |
T |
|
| Q |
214 |
ggaattatatttttctgtcggggatgtccgatctctctcttctatgtcgttgatttaattagtttcaaccaaacaatggt |
293 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
10092191 |
ggaattatatttttctgacggggatgtccgatctctctcttctatgtcgtagatttaatttgtttcaaccaaacaatggt |
10092270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 149 - 325
Target Start/End: Original strand, 10092342 - 10092517
Alignment:
| Q |
149 |
catcagaaacgagaggggtggcaatggtgagtccgggggcgttgatggtgtttcccaggagttcgggaattatatttttctgtcggggatgtccgatctc |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||| ||||||||||| |||||| ||||| || |||| ||||| |||| || ||||||| | || |
|
|
| T |
10092342 |
catcagaaatgagaggggtggcaatggtgagtctgggg-cgttgatggtgattcccaagagtttggaaattttatttctctgacgaggatgtctggcatc |
10092440 |
T |
|
| Q |
249 |
tctcttctatgtcgttgatttaattagtttcaaccaaacaatggtgctatgattagattggatcactttatgatgtc |
325 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10092441 |
cctcttctaggtcgtagatttaattagtttcaacaaaacagtggtgctatgattagattggatcactttatgatgtc |
10092517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University