View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_33 (Length: 305)
Name: NF8580_low_33
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 4032197 - 4031912
Alignment:
| Q |
1 |
aagagaataggatttggcaatgataatgaggatgagaaaggtagtgcttgtactttgcttccatgtataaatagtttgaagaatgaggaaggtaatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032197 |
aagagaataggatttggcaatgataatgaggatgagaaaggtagtgcttgtactttgcttccatgtataaatagtttgaagaatgaggaaggtaatgatg |
4032098 |
T |
|
| Q |
101 |
agagtgaagtagatgtagatggaggagggaaaggagaaggtgaattggtgacaattgacaaaggttttaggattgagcttgatgagcttttgaaggcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032097 |
agagtgaagtagatgtagatggaggagggaaaggagaaggtgaattggtgacaattgacaaaggttttaggattgagcttgatgagcttttgaaggcatc |
4031998 |
T |
|
| Q |
201 |
agcatatgtgttagggaagagtgcattagggattgtgtataaggtggtgcttggaaatgggatgccggtggcggtgaggagattag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031997 |
agcatatgtgttagggaagagtgcattagggattgtgtataaggtggtgcttggaaatgggatgccggtggcggtgaggagattag |
4031912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 131 - 284
Target Start/End: Original strand, 25882603 - 25882756
Alignment:
| Q |
131 |
aaggagaaggtgaattggtgacaattgacaaaggttttaggattgagcttgatgagcttttgaaggcatcagcatatgtgttagggaagagtgcattagg |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| |||| |||||||| | || | ||| || ||||||||||||||||| |||| ||||| |
|
|
| T |
25882603 |
aaggagaaggtgaattggtggcaattgataaaggttttagctttgaacttgatgaattgttaagggcttctgcatatgtgttagggaaaagtgggttagg |
25882702 |
T |
|
| Q |
231 |
gattgtgtataaggtggtgcttggaaatgggatgccggtggcggtgaggagatt |
284 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | || || || ||||||||||| |
|
|
| T |
25882703 |
gattgtgtataaggtagtgcttgggaatggggtacctgtagctgtgaggagatt |
25882756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University