View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_46 (Length: 252)
Name: NF8580_low_46
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 4554478 - 4554249
Alignment:
| Q |
14 |
caatatcaaatctcacacaacattcaacagtgtaagatattgtctagtataccaaagaaaactttttaccttaatggtttttaacgagtgttttctaaga |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4554478 |
caatatcaaatctaacacaacattcaacagtgtaagatattgtctagtataccaaagaaaactttttaccttaatggtttttaatgagtgttttctaaga |
4554379 |
T |
|
| Q |
114 |
tggtgtaattttttctcaacttccaaaaccttctgtcttgagaacgagtcatcattgttagtaccataaactgtaatgcaaagcaccaagagcatgaata |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554378 |
tgctgtaattttttctcaacttccaaaaccttctgtcttgagaacgagtcatcattgttagtaccataaactgtaatgcaaagcaccaagagcatgaata |
4554279 |
T |
|
| Q |
214 |
ttactttggatcccatggctaaagaataat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4554278 |
ttactttggatcccatggctaaagaataat |
4554249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University