View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_47 (Length: 250)
Name: NF8580_low_47
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 36464693 - 36464935
Alignment:
| Q |
1 |
aactgtgacatacaattcaattcaaaacgaggtgctccaaacacttatgaattagaagtagaaggatatatagaaaaatg---------ttattcctcaa |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36464693 |
aactgtgacatacaattcaattcaaaacgaggtgctcaaaacacttatgaattagaagtagaaggatatatagaaaaatggttgagatattattcctcaa |
36464792 |
T |
 |
| Q |
92 |
gttgctcttttacattctctcactaactcctccaactctcactctcttaaccaagaatgtctctactctcatcatagtagtggcatatccttccttaatt |
191 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36464793 |
gttgctctttcacattctctcactaactcctccaactctcactctcttaaccaagaatgtctctactctcatcatagtagtggcata----tccttaatt |
36464888 |
T |
 |
| Q |
192 |
gagcaatcgaagcttaaccgcagaatactttatattttccgcttctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464889 |
gagcaatcgaagcttaaccgcagaatactttatattttccgcttctc |
36464935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University