View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_51 (Length: 242)
Name: NF8580_low_51
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 339095 - 338903
Alignment:
| Q |
47 |
taaatgctaaggacaatcactttttaacactattttggtggatgaaatcaatgaatgtatatctcacgattttaaatgggaaccataaaagagtgaattt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
339095 |
taaatgctaaggacaatcactttttaacactattttggtggatgaaatcaatgaatgtatatctcacgattttaaatggaaaccataaaagagtgagttt |
338996 |
T |
 |
| Q |
147 |
tagaggaaatgttgcttgcactattcaaaactaaaaaagcaatggtaatataaataagagtcttgctaaccattaccctaaacattgctctca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||| | | |||||||| |||| |
|
|
| T |
338995 |
tagaggaaatgttgcttgcactattcaaaactaaaaaaacaatggtaatataaacaagggtcttgctaaccattatcttgaacattgccctca |
338903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University