View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_54 (Length: 237)
Name: NF8580_low_54
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 47123814 - 47124033
Alignment:
| Q |
3 |
aaattcaagtagtttgtttggcacaatatatgtcgttcctatttgactacaatgaatgttttccttttttcaaagtcactctttattaatagatgaaaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47123814 |
aaattcaagtagtttgtttggcacaatacatgtcgtgcctagttgacgacaatgagtgttttccttttttcaaagtcactctttattaataaatgaaaaa |
47123913 |
T |
 |
| Q |
103 |
ggaaaaatatttcacattccatttgatgacaataaattgtatcataggtattcatgttgagattgccgaagcaaaatctaaatattggtctacttttgca |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123914 |
ggaaaaatatttcacattctatttgatgacaataaattgtatcataggtattcatgttgagattgccgaagcaaaatctaaatattggtctacttttgca |
47124013 |
T |
 |
| Q |
203 |
cctaacaatccagttgatgt |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47124014 |
cctaacaatccagttgatgt |
47124033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University