View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8580_low_58 (Length: 221)

Name: NF8580_low_58
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8580_low_58
NF8580_low_58
[»] chr2 (1 HSPs)
chr2 (1-221)||(45246188-45246412)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45246412 - 45246188
Alignment:
1 aaatagtatttcttcatacttggtgatacaaattgtctatcattttgacaaagtatttagtatttctgctatctgtcttagcagagtctgaaatcatgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45246412 aaatagtatttcttcatacttggtgatacaaattgtctatcattttgacaaagtatttagtatttctgctatctgtcttagcagagtctgaaatcatgta 45246313  T
101 ccga----atagcacaagtatgagaacttgagtaaaatatctattcatttaattatatgtaatgatgaagaatcaaagcacaaatatatttgagttcaaa 196  Q
    ||||    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45246312 ccgatcgaatagcacaaatatgagaacttgagtaaaatatctattcatttaattatatgtaatgatgaagaatcaaagcacaaatatatttgagttcaaa 45246213  T
197 tgacaaaatacacaatgataaagaa 221  Q
    |||||||||||||||||||||||||    
45246212 tgacaaaatacacaatgataaagaa 45246188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University