View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8580_low_60 (Length: 208)

Name: NF8580_low_60
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8580_low_60
NF8580_low_60
[»] chr5 (1 HSPs)
chr5 (18-194)||(41142823-41143002)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 41142823 - 41143002
Alignment:
18 tttccaataaatttatttaaagtaacaccaaaccaattcgataatgatcaaaatattacttaatagagtatagccccatnnnnnnnngtta---tagtac 114  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |        ||||   ||| ||    
41142823 tttccaataaatttatttaaagtaacaccaaaccaattagataatgatcaaaatattacttaatagagtatagccccgtaaaaaaaagttaatatagaac 41142922  T
115 gaagtatgtttagcttctctttaattctatgaaataacaaaatgctacactcacccacaattggatagaaggagtattat 194  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41142923 taagtatgtttagcttctctttaattctatgaaataacaaaatgctacactcacccacaattggatagaaggagtattat 41143002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University