View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8580_low_61 (Length: 204)
Name: NF8580_low_61
Description: NF8580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8580_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 37593083 - 37592983
Alignment:
| Q |
1 |
atcttaaatgagtgtagaaaataataaagtgtctaaatattttgattgctcgtcgtgttaataacatggtaagaagatataaaatcaaacaacacccata |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37593083 |
atcttaaatgagtgtaaaaaataataaagtgtctaaatattttgattgctcgtcgtgttaataacatggtaagaagatataaaatcaaacaacacccata |
37592984 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
37592983 |
t |
37592983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University