View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_high_17 (Length: 370)
Name: NF8581_high_17
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 12 - 351
Target Start/End: Original strand, 39076970 - 39077309
Alignment:
| Q |
12 |
cctgtgttgagttgtttgttcttgagattatatcagaagagtagctttgaaaattcatagattcaccaacagaagttgttggaaaaaatgctatagcatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076970 |
cctgtgttgagttgtttgttcttgagattatatcagaagagtagctttgaaaattcatagattcaccaacagaagttgttggaaaaaatgctatagcatc |
39077069 |
T |
 |
| Q |
112 |
attatcaatagttgattgaatgaaacctgaatggttatggttatgatgattgttctgctgcaaattgtaaccagaagattctgattgttctgctgcaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077070 |
attatcaatagttgattgaatgaaacctgaatggttatggttatgatgattgttctgctgcaaattgtaaccagaagattctgattgttctgctgcaata |
39077169 |
T |
 |
| Q |
212 |
accatttcatttgtttctactgcatttttattattattctcttcctcttgtaactcttctgttgcatttggaattggattccatggtggaagctgatcaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077170 |
accatttcatttgtttctactgcattattattattattctcttcctcttgtaactcttctgttgcatttggaattggattccatggtggaagctgatcaa |
39077269 |
T |
 |
| Q |
312 |
gtttgtcaatggcagacttagcctttttgataagccaatc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077270 |
gtttgtcaatggcagacttagcctttttgataagccaatc |
39077309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University