View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_high_28 (Length: 272)
Name: NF8581_high_28
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 23 - 256
Target Start/End: Complemental strand, 40405926 - 40405693
Alignment:
| Q |
23 |
tatatttgtctatccttgaaattgtcataagtcaaaactgacatcagtcaagctagtcaaattctcaatctcagccatgtggatgaggaaaactttaagc |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405926 |
tatatttgtctatccttgaatttgtcataagtcaaaactgacatcagtcaagctagtcaaattctcaatctcagccatgtggatgaggaaaactttaagc |
40405827 |
T |
|
| Q |
123 |
ttctactttcaaaaggcaacatgtcagtcactattgaaatttttatcgagtttttcaagcacaggactaattttcaaaagagcataaccttgaaagtata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405826 |
ttctactttcaaaaggcaacatgtcagtcactattgaaatttttatcgagtttttcaagcacaggactaattttcaaaagagcataaccttgaaagtata |
40405727 |
T |
|
| Q |
223 |
gaatattatagtacatactcagtttcgtaaatcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40405726 |
gaatattatagtacatactcagtttcgtaaatcc |
40405693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University