View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_high_34 (Length: 241)
Name: NF8581_high_34
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_high_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 5389913 - 5389691
Alignment:
| Q |
19 |
cttctacctttaagcaatgtgattgtatgatttaaagagtgataattcaaacttttgacccagctatcatctagctaggtaaaaatctcagcaatttgac |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5389913 |
cttctacttttaagcaatgtgattgtatgatttaaagagtgataattcaaacttttgacccagctatcatctagctaggtaaaaatctcagcaatttgac |
5389814 |
T |
 |
| Q |
119 |
aacaaatggcaattcaacaaacattttatggcatgaatgttcaatccagaagcttgatagacagcaactacttcaacaaaaaggctgtgttgtctgggta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5389813 |
aacaaatggcaattcaacaaacattttatggcatgaatgttcaatccagaagcttgatagacagcaactacttcaacaaaaaggctgtgttgtctgggta |
5389714 |
T |
 |
| Q |
219 |
actggtctcagtggttcaggttt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5389713 |
actggtctcagtggttcaggttt |
5389691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 173 - 241
Target Start/End: Original strand, 39961068 - 39961136
Alignment:
| Q |
173 |
tgatagacagcaactacttcaacaaaaaggctgtgttgtctgggtaactggtctcagtggttcaggttt |
241 |
Q |
| |
|
|||||||||||| || ||||| |||||||| |||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
39961068 |
tgatagacagcagctgcttcagcaaaaaggatgtgttatatggctaactggtctcagtggttcaggttt |
39961136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University