View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_high_36 (Length: 228)
Name: NF8581_high_36
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_high_36 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 10169428 - 10169655
Alignment:
| Q |
1 |
cttagttttgatgccgctataaaagcaactcattcgtaatacgagtctcgttggcttcggtgctttatgaagaaagtattgtgcttccaacacgacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10169428 |
cttagttttgatgccgctataaaagcaactcattcgtaatacgagtctcgttggcttcggtgctttatgaagaaagtattgtgcttccaacacgacatat |
10169527 |
T |
|
| Q |
101 |
gagttgttagttgtctttaatggcatcattcttgcttgggattagggctttaagaatgagattattaaatttgattccaacatttctcggagcttatttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10169528 |
gagttgttagttgtctttaatggcatcattcttgcttaggattagggctttaagaatgagattattaaatttgattccaacatttctcggagcttatttc |
10169627 |
T |
|
| Q |
201 |
tacttaccacacacgttattctagcaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10169628 |
tacttaccacacacgttattctagcaac |
10169655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University