View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_low_23 (Length: 371)
Name: NF8581_low_23
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 148 - 349
Target Start/End: Original strand, 25002463 - 25002653
Alignment:
| Q |
148 |
atttaggcaagaatggtaagtccgtgatatgcacgtggaatgaaaaacacagaatgaattaaccctagatttgctccatacgtaattaacatccagatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
25002463 |
atttaggcaagaatggtaagtccgtgatatgcacgtggaatgaaaaacacaaaatgaattaaccctagatttgctccatacgta-------tcca-ataa |
25002554 |
T |
 |
| Q |
248 |
tctgctgcctccgccgaaaccaaccgttacttccctctaccgaccatctcttataaatacttttctaccctttcactcacactcacacacctcttcatac |
347 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25002555 |
tctgc---ctccgccgaaaccaaccgttgcttccctctaccgaccatctcttataaatacttttctaccctttcactcacactcacacacctcttcatac |
25002651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University