View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_low_29 (Length: 335)
Name: NF8581_low_29
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 109 - 318
Target Start/End: Complemental strand, 5474055 - 5473844
Alignment:
| Q |
109 |
tatgctttattcacttaagatcacatatac-tactatatagctatat--tcaagggaaaggagccctctttttcatctcagtttcttggaagtcaatgac |
205 |
Q |
| |
|
||||||||||||||| ||||| ||||||| || | |||| |||||| |||||| |||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
5474055 |
tatgctttattcactcaagattacatatatatagt-tatatctatatgttcaaggaaaaggagccctctttttcatttcagtttcttcaaagtcaatgac |
5473957 |
T |
|
| Q |
206 |
aaaaccttttccatgctgtttccaatagtcagccattgggtggatcatctctggttctggaatctcaatcctcgagcttttaaggctctctgaggaaatt |
305 |
Q |
| |
|
||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5473956 |
aaagcctttgccatgttgcttccaatagtcagccattgggtggatcatctctggctctggaatctcaatcctcgagcttttaaggctctctgaggaaatt |
5473857 |
T |
|
| Q |
306 |
ttgtatttggtgt |
318 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5473856 |
ttgtatttggtgt |
5473844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 248 - 301
Target Start/End: Complemental strand, 5479996 - 5479943
Alignment:
| Q |
248 |
gatcatctctggttctggaatctcaatcctcgagcttttaaggctctctgagga |
301 |
Q |
| |
|
|||||| | ||| |||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
5479996 |
gatcatttatggatctggaatctcaatcctcgagcttttcaggctcgctgagga |
5479943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University