View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_low_43 (Length: 259)
Name: NF8581_low_43
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 39743395 - 39743167
Alignment:
| Q |
20 |
gaccagtgatgagagaagagacttcaccatttgcaattctctgtatatatggaaagattccttcgtagctaataactggaacacaacgcttaaactcttt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39743395 |
gaccagtgatgagagaagagacttcaccatttgcaattctctgtatatatggaaagattccttcgtaactaataactggaacacaacgcttaaactcttt |
39743296 |
T |
|
| Q |
120 |
taaatctgttttaaatgtttctctcttcatatactgatttaaatactcagtttccttattctgtgttaagatatgtttcaaaaggttatcttgaacctca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39743295 |
taaatctgttttaaatgtttctctcttcatatactgatttaaatactcagtttccttattctgtgttaagatctgtttcaaaaggttatcttgaacctca |
39743196 |
T |
|
| Q |
220 |
ccagcattcattgttagcctctctatctc |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
39743195 |
ccagcattcattgttagcttctctatctc |
39743167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University