View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8581_low_58 (Length: 213)
Name: NF8581_low_58
Description: NF8581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8581_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 28250112 - 28250309
Alignment:
| Q |
1 |
gaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250112 |
gaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacgg |
28250211 |
T |
|
| Q |
101 |
aggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagagattgataattaactgtagaaggcttcgttgttttgatctgatgtc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28250212 |
aggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataattaactctagaaggcttcgttgttttgatctgatgtc |
28250309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 32179733 - 32179846
Alignment:
| Q |
41 |
attcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttct |
140 |
Q |
| |
|
||||| |||||||||||| ||||| || | |||||||| |||| ||| || |||||||| || ||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
32179733 |
attcgcttctcgagttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttct |
32179832 |
T |
|
| Q |
141 |
ctgaagggaagaga |
154 |
Q |
| |
|
| || || |||||| |
|
|
| T |
32179833 |
ccgacggaaagaga |
32179846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University