View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8582_low_10 (Length: 211)
Name: NF8582_low_10
Description: NF8582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8582_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 78 - 195
Target Start/End: Complemental strand, 35299120 - 35299004
Alignment:
| Q |
78 |
ttgcaatgatatatttcaattttgtttagggaccaatacccaaccacaccatgtttgcaagattgcatgcatggttggagtaaacaagtgtggagtgagc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| |
|
|
| T |
35299120 |
ttgcaatgatatatttcaattttgtttagggaccaatacccaaccacaccatgtttgcaagattgtatgcatggttggagt-aacaagtgtggagtcagc |
35299022 |
T |
 |
| Q |
178 |
ttttggtagttcaacatt |
195 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35299021 |
ttttggtagttcaacatt |
35299004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University