View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8582_low_8 (Length: 232)
Name: NF8582_low_8
Description: NF8582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8582_low_8 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0212 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 12005 - 12236
Alignment:
| Q |
1 |
gactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagctgcttcgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12005 |
gactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagctgcttcgag |
12104 |
T |
|
| Q |
101 |
cattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaagaagcttgtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12105 |
cattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaagaagcttgtgc |
12204 |
T |
|
| Q |
201 |
atctttctattttatgtttgttgatggatcta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12205 |
atctttctattttatgtttgttgatggatcta |
12236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 35 - 232
Target Start/End: Original strand, 16576868 - 16577065
Alignment:
| Q |
35 |
ttattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagctgcttcgagcattggtatgaaacccggaatattttatttgaaa |
134 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| || ||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16576868 |
ttattaaggttatcagataagctccaggtttagttgtagtttcgtggatagaggagttgcttcgagtattggtatgaaacccgaaatattttatttgaaa |
16576967 |
T |
|
| Q |
135 |
tcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaagaagcttgtgcatctttctattttatgtttgttgatggatcta |
232 |
Q |
| |
|
||| ||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
16576968 |
tcgtgatgagttaaagaaatcaacccgaaattcagtccatgataggatagggaaagaagcttgtgcatctttctattttacaattgatgatggatcta |
16577065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 9628888 - 9628815
Alignment:
| Q |
1 |
gactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagt |
74 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9628888 |
gactgcctagatatagagcagattttgtccatgattattaaggtaactagataagctccaggtttagttgtagt |
9628815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University