View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8583_low_10 (Length: 300)
Name: NF8583_low_10
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8583_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 50550525 - 50550576
Alignment:
| Q |
1 |
ctccaatgactttatctctatcttcagccatgtcaaacttcatcatataaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50550525 |
ctccaatgactttatctctatcttcagccatgtcaaacttcatcgtataaaa |
50550576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University