View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8583_low_11 (Length: 270)

Name: NF8583_low_11
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8583_low_11
NF8583_low_11
[»] chr7 (1 HSPs)
chr7 (19-166)||(30233344-30233491)
[»] chr2 (1 HSPs)
chr2 (142-252)||(34044633-34044743)
[»] chr8 (1 HSPs)
chr8 (142-252)||(4044849-4044959)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 166
Target Start/End: Complemental strand, 30233491 - 30233344
Alignment:
19 ttcactaccatcacaacacaggaagaaaacggcggaaataataaaaatccagtagatactggaaatccnnnnnnnatttgttaaccgttgtggcttctca 118  Q
    ||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||        ||||||||||||||||||||||||    
30233491 ttcactaccatcacagcacaggaagaaaatggcggaaataataaaaatcctgtagatactggaaatcctttttctgtttgttaaccgttgtggcttctca 30233392  T
119 ccatcctttgccttgccacccaacgtcttcatcttctttggatgttcc 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
30233391 ccatcctttgccttgccacccaacgtcttcatcttctttggatgttcc 30233344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 142 - 252
Target Start/End: Complemental strand, 34044743 - 34044633
Alignment:
142 cgtcttcatcttctttggatgttccagcttctttaatttcctcttggggtactgccacaactttacttgtagtggagcgagttcctggttcagtgctctc 241  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
34044743 cgtcttcattttctttggatgttccagcttctttaatttcctcttggggtactgccgcaactttacttgtagtggagcgagttcctggttcagtgctctc 34044644  T
242 aatctggatgt 252  Q
    |||||||||||    
34044643 aatctggatgt 34044633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 142 - 252
Target Start/End: Original strand, 4044849 - 4044959
Alignment:
142 cgtcttcatcttctttggatgttccagcttctttaatttcctcttggggtactgccacaactttacttgtagtggagcgagttcctggttcagtgctctc 241  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||  || ||||||  |||||||||||  |||||||||||||||| ||||||||||||    
4044849 cgtcttcatcttcttcggatgttccagcttctttgatttcctcttcagggactgccgtaactttacttgaggtggagcgagttcctgattcagtgctctc 4044948  T
242 aatctggatgt 252  Q
    |||||||||||    
4044949 aatctggatgt 4044959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University