View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8583_low_12 (Length: 247)
Name: NF8583_low_12
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8583_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 14848016 - 14847787
Alignment:
| Q |
1 |
ttacagaaaaataaggaattttaagatgcatgctgaccttaaacgaatgaaaattagaggaagaaagggagaaaacgttgagggatagggtttatacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14848016 |
ttacagaaaaataaggaattttaagatgcatgctgacctgaaacgaatgaaaattagaagaagaaatggagaaaacgttgagggatagggtttatacgaa |
14847917 |
T |
|
| Q |
101 |
accctagaaattgggggaatttgaatttggtgatgtttacgaagaagaagaagtagaacgcgtaaaaataaaggttgcgtgatgaagttgtgaatattta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14847916 |
accctagaaattgggggaatttgaatttggtgatgtttacgaagaagaagaagaagaacgcgt-aaaataaaggttgcgtgatgaagttgtgaatattta |
14847818 |
T |
|
| Q |
201 |
taaataaatgaataagttagttggttggtga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14847817 |
taaataaatgaataagttagttggttggtga |
14847787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University