View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8583_low_12 (Length: 247)

Name: NF8583_low_12
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8583_low_12
NF8583_low_12
[»] chr3 (1 HSPs)
chr3 (1-231)||(14847787-14848016)


Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 14848016 - 14847787
Alignment:
1 ttacagaaaaataaggaattttaagatgcatgctgaccttaaacgaatgaaaattagaggaagaaagggagaaaacgttgagggatagggtttatacgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
14848016 ttacagaaaaataaggaattttaagatgcatgctgacctgaaacgaatgaaaattagaagaagaaatggagaaaacgttgagggatagggtttatacgaa 14847917  T
101 accctagaaattgggggaatttgaatttggtgatgtttacgaagaagaagaagtagaacgcgtaaaaataaaggttgcgtgatgaagttgtgaatattta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
14847916 accctagaaattgggggaatttgaatttggtgatgtttacgaagaagaagaagaagaacgcgt-aaaataaaggttgcgtgatgaagttgtgaatattta 14847818  T
201 taaataaatgaataagttagttggttggtga 231  Q
    |||||||||||||||||||||||||||||||    
14847817 taaataaatgaataagttagttggttggtga 14847787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University