View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8583_low_15 (Length: 220)
Name: NF8583_low_15
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8583_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 52 - 187
Target Start/End: Complemental strand, 52549114 - 52548983
Alignment:
| Q |
52 |
aatggtggcacatttgttaactactatatggtaaggatggatatatcattgaagttgtggtttatgtattcattttatgccttgtaaactctgactttag |
151 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52549114 |
aatggtggcacattcgttaactactatatggtaaggat----aaatcattgaagttgtggtttatgtattcatttcatgccttgtaaactctgactttag |
52549019 |
T |
|
| Q |
152 |
tgtatcattgttttggcctagtatcatggaggaact |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52549018 |
tgtatcattgttttggcctagtatcatggaggaact |
52548983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 6 - 84
Target Start/End: Original strand, 17126450 - 17126528
Alignment:
| Q |
6 |
tagaccagcagaagatgtggcattctctgttgcaagatttgtacaaaatggtggcacatttgttaactactatatggta |
84 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||| ||||| ||| | ||| ||| ||||||||||||||||||| |
|
|
| T |
17126450 |
tagaccagcagaagacttggcattctcggttgccagattcgtacagaatcgcggctcatatgttaactactatatggta |
17126528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 84
Target Start/End: Original strand, 5230867 - 5230945
Alignment:
| Q |
6 |
tagaccagcagaagatgtggcattctctgttgcaagatttgtacaaaatggtggcacatttgttaactactatatggta |
84 |
Q |
| |
|
||||||| | ||||| |||||| ||| ||||| ||||| |||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
5230867 |
tagaccaactgaagacttggcatactcagttgctagattcatacaaaatcgtggctcctttgttaactactatatggta |
5230945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University