View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8583_low_5 (Length: 384)
Name: NF8583_low_5
Description: NF8583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8583_low_5 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 162 - 384
Target Start/End: Original strand, 50550327 - 50550549
Alignment:
| Q |
162 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatccctgggaaacgaac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50550327 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatgcctgggaaacgaac |
50550426 |
T |
 |
| Q |
262 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccgggctccatttagcaacagcaaggtagtgatcaaagatcatccacggaccctct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
50550427 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccaggctccatttagcaacagtaaggtaatgatcaaagatcatccacagaccctct |
50550526 |
T |
 |
| Q |
362 |
ccaatgactttatccctatcttc |
384 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
50550527 |
ccaatgactttatctctatcttc |
50550549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 71
Target Start/End: Original strand, 50550269 - 50550324
Alignment:
| Q |
16 |
ataacacccacaaccactacaaatcagatgctatccctcataagccaccttgtacc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50550269 |
ataacacccacaaccactacaaatcagatgtaatccctcataagccaccttgtacc |
50550324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University